கொரோனா சோதனை (PCR test) என்றால் என்ன?

Spread the love

கொரோனா சோதனை (PCR test) என்றால் என்ன?

Alwar Narayanan

கொரோன சோதனை (PCR test) என்றால் என்ன? அதை சுலபமாக செய்ய முடியுமா ? நமக்கு இருக்கும் 10ம் வகுப்பு பாட உயிரியல் அடிப்படை அறிவை வைத்து சுலபமாக புரிந்து கொள்வோம்.

மனித உடல் மட்டுமல்ல, எல்லா உயிரினங்களும் நுண்ணிய செல்களால் (உயிரணு) ஆனது. புதிய உயிரணுக்கள் பிறந்து பழையவை இறப்பதுதான் நம் உடல் வளர்ச்சி. மனித உடலில் 40 லட்சம் கோடி செல்கள் உள்ளன.

நாம் கற்படியில் கால் தேய்த்து அலம்பும்போது வெள்ளையாக படிவது பாதத்தின் மேல் தோலின் இறந்த செல்கள். அதேபோல உடலுக்குள் உள்ள செல்கள் இறந்தவுடன் மார்கோபஃஸ் (macrophages) எனப்படும் வெள்ளை அணுக்களால் கரைந்து ரத்தம் மூலம் மலமூத்திரத்தில் வெளியேற்றப்படும். இது சரிவர நடக்கவில்லையென்றால் இந்த கொழுப்பு (plaque) ரத்தக்குழாயில் படிந்து மாரடைப்பு வரை கொண்டுசெல்லும். அது சரியாக கலப்பதற்குத்தான் உடற்பயிற்சி செய்யவேண்டும்.

ஒவ்வொரு செல்லுக்குள்ளும் இருப்பது சைட்டோபிளாசம் (cytoplasmic region) எனப்படும் நிணநீர். அதனுள் மிதப்பது புரதம், மைட்டோகாண்ட்ரியா (mitochondria) மற்றும் நியூக்ளிக் அமிலம் என்ற கரு ( proteins and nucleic acids). மைட்டோகாண்ட்ரியாதான் நமக்கு சக்தியை கொடுக்கிறது. அது சாப்பிட கொழுப்பும், ஆக்சிஜனும் தேவை.

இனி முக்கியமான கட்டம்.

உயிரணுவின் கருவில் அனைத்து வகையான உயிரணுக்களிலும் காணப்படும் பாலிமர்களாக இரண்டு வகையான நியூக்ளிக் அமிலங்கள் உள்ளன. DNA மற்றும் RNA . (Deoxyribonucleic Acid – DNA, Ribonucleic Acid -RNA). இந்த DNA தான் படங்களில் திருகிய ஏணி போல (double helix) காணப்படும். உயிரின் ஆதாரம் இதில்தான் உள்ளது. மீண்டும் மீண்டும் பிரதி எடுக்கப்பட்டு உடலில் உள்ள 4 லட்சம் கோடி உயிரணுக்களிலும் உங்கள் விவரங்கள் இந்த ஒவ்வொரு DNA விலும் இருக்கும். ஆகவே தான் அதை அடையாளம் காண DNA டெஸ்ட் எடுக்கிறார்கள். இந்த ஏணியின் இரண்டு கால்களை பிரித்தால் அது RNA.. மேலும் 8ம் வகுப்பை ஒழுங்காக படித்திருந்தால் இந்த ஏணிப்படிகள் முறையே அடினீன், சைட்டோசின், குவானைன், தைமைன் மற்றும் யுரேசில் (adenine, cytosine, guanine, thymine, and uracil) என்ற புரதங்களால் ஆனது என்று படித்திருக்கலாம் (3 மார்க்கு).

கொரானா வைரஸ் என்பது முழுமைபெறாத ஒரு உயிரணு. RNA வை புரதங்களால் போர்த்தி, எல்லா பக்கமும் கொம்புகளை சொருகிவைத்தால் அதுதான் கொரானா !

corona-virus
corona-virus

 

கொரானாவை எப்படி கண்டுபிடிக்கிறார்கள்

இப்போது இந்த கொரானாவை எப்படி கண்டுபிடிக்கிறார்கள் என்று பார்ப்போம்.

உங்கள் மூக்கில் அல்லது தொண்டையில் தோய்த்து எடுக்கப்படும் சளி மாதிரியில் பல ஆயிரம் கிருமிகள் இருக்கலாம்.அதில் ஒன்றுதான் கொரானா. கண்டுபிடிக்க முடியாது. ஆகவேதான் பின்வரும் வழிமுறையை கையாள்கின்றனர்.

PCR – Polymerase chain reaction எனப்படும் பாலிமர் சங்கிலி சோதனை.

பாலிமர் சங்கிலி சோதனை
கொரோனாவை கண்டுபிடிக்க வேண்டுமென்றால், முதலில் நோயாளியின் சளியில் இருக்கும் கொரோனாவின் DNA வை (ஒருவேளை இருந்தால்) பல கோடி மடங்காக பிரதி எடுக்க வேண்டும். பிறகு அதை எளிதாக பார்த்துவிடலாம். எப்படி என்று பார்ப்போம்.

கொரோனாவின் கையொப்பம் (Genome sequencing)
அதற்கு முன் ஒரு முக்கிய வேலையை செய்யவேண்டும். கொரோனா வைரசுக்கு உள்ள பிரத்யேக அடையாளத்தை அதன் ஜீன் எனப்படும் RNA வில் இருந்து கண்டுபிடிக்கவேண்டும். ஜனவரியில் செய்தி தாள்களில் அடிக்கடி Genome sequencing என்ற வார்த்தை வந்தது நினைவிருக்கலாம். ஒவ்வொரு நாடும் போட்டிபோட்டுக்கொண்டு இந்த கொரானாவின் வடிவமைப்பை ஐ.நாவில் பதிவு செய்தது. உதாரணத்துக்கு அது இப்படி இருக்கலாம் “CGGAATTCGATGTCTTATACTCCCGGT”. இதில் C-சைட்டோசின், G -குவானின்…….. என்று DNA ஏணியின் படிகள் மாற்றி மாற்றி வரும் என்பது விளங்கி இருக்கும். இதுதான் கொரோனாவின் கையொப்பம்.

PCR எந்திரத்தில் சளி அல்லது ரத்த மாதிரியை ஒரு சோதனைக்குழாயில் போட்டு அதனோடு ஒரு பாலிமரை சேர்ப்பார்கள். அது Taq polymerase எனப்படும் வெந்நீர் ஊற்றுகளில் வளரும் ஒரு வித பாக்டீரியாவிலிருந்து (microorganism Thermus aquaticus,) எடுக்கப்படும் DNA வாகும். (அதனால்தான் 4500/- ரூபாய் ஆகிறது). அதனோடு மேலும் சில ரசாயனங்களை சேர்த்து குலுக்கி 95டிகிரி வெப்பத்தில் இரண்டு நிமிடம் வைப்பார்கள். அப்போது வைரஸின் DNA ஏணி, இரண்டு இழையாக பிரியும். இது தலைவாரும் சீப்பைபோல இருக்கும். பிறகு வெப்பத்தை குறைப்பார்கள். இப்போது ஒவ்வொரு சீப்போடும் மேற்சொன்ன பாலிமர் சீப்பு ஒட்டிக்கொள்ளும். கிருமியின் இரண்டு DNA பிரதிகள் இப்போது கிடைக்கும் அல்லவா?

நாம் இரண்டு சீப்பை கையில் வைத்துக்கொண்டு பல்லோடு பல் ஒட்டும்படி வைத்து விளையாடுவது இல்லையா ? அதுபோல. பற்கள் தவரானால் ஒட்டாது. சிடுக்கு சீப்போடு பேன் சீப்பு பொருந்தாது.

இப்படியே மறுபடியும் வெப்பத்தை கூட்டினால் அவை 4 இழையாக ஆக பிரியும். மேலும் பாலிமர் சேர்த்து குளிர்வித்தால் இப்போது 4 முழு DNA பிரதி கிடைக்கும். அடுத்து 8, 12, 24, 48,…….. இந்த விதத்தில் PCR எந்திரம் மூலம் ஒரு 5 மணி நேரத்தில் கோடிக்கணக்கான DNA துண்டுகளை உருவாக்க முடியும்.

அதன் பிறகு ஒரு குடுவையில் அதை மைய விலக்கு விசைமூலம் பிரித்து (வெண்ணை கடைவதைப்போல) சுலபமாக கொரோனா இருக்கிறதென்று அல்லது இல்லை என்று கண்டுபிடித்து விடுவார்கள். போக்குவரத்து உட்பட இதெல்லாம் முடிவதற்கு 2 நாளாகும். (அதற்குள் நோயாளி பயத்தில் உயிரை விடுவார் !!!)

கொரோனா PCR மூலம் கொரானா மட்டும்தான் இருக்கிறதா என்று பார்க்க முடியும். HIV என்றால் அதற்க்கு வேறு PCR கிட். ஒவ்வொரு வைரசுக்கும் ஒவ்வொரு கிட். எனவேதான் இன்றைக்கு 6 லட்சம் டெஸ்ட் எடுத்தால் அதில் 3% தவறுதலாக என்றால் கூட அது 18000 பேருக்கு தவறாக வரும். அதுபோல சரியான ரசாயனம் அல்லது போலி என்றால் கேட்கவே வேண்டாம்.

இந்தியாவில் இதை இப்போது மலிவு விலையில் தயார் செய்ய Mylab, pune கம்பெனியில் ஏற்பாடு நடக்கிறது. இருந்தாலும் தற்போது நம்மிடம் 5000 PCR எந்திரங்கள்தான் உள்ளன.

Alwar Narayanan from Facebook

Leave a Reply

Your email address will not be published. Required fields are marked *